Polymorphism of exon 2 of MHC Class II B gene in the Chinese concave- eared torrent frog (Odorrana tormota)

doi:10.3724/SP.J.1003.2012.09211

Abstract

Abstract:

Currently, amphibians are experiencing global population decline, and it is believed that several amphibian mass extinction events were caused by environmental pathogens (such as chytrid fungus). Major histocompatibility complex (MHC) genes play a critical role in the course of immune response in all jawed vertebrates. MHC gene is considered to be one of the best candidates to analyze animal’s adaptive evolution because its polymorphisms are usually associated with resistance or susceptibility to animal diseases. Here, we report our preliminary research on the allelic diversity of MHC class II B gene from the Chinese concave-eared frog (Odorrana tormota), a species endemic to eastern China. We initially amplified a 180-bp fragment of MHC II exon2 gene in O. tormota using published polymerase chain reaction primers. Based on these results, we successfully obtained sequences of the gene’s flanking regions using a ligation-mediated PCR method. After splicing, we obtained a sequence with length of 2,030 bp including whole exon2 and partial sequences of intron1 and intron2. Then two exon2-specific primers (IIQ1BU/IIQ1BD) were designed for the species and were used to investigate the B gene diversity of a wild population (Huangshan Mt., n=32) using PCR, cloning and sequencing. In total, 34 distinct alleles were obtained and 2 to 5 alleles were found per individual. The proportion of variable sites for nucleotide and amino acid sequences across the 34 alleles was 16.17% (33/204) and 26.87% (18/67), respectively, and the majority of variable amino acids were located in antigen binding sites (ABS). Based on cDNA data and individual allelic diversity, we conclude that O. tormota possesses at least three class II B loci. These results showed that though the species exhibits a restricted distribution, the Chinese concave-eared frog displays high diversity at the B loci compared to that of other species in Ranidae. Patterns of nucleotide substitution exhibited the signature of positive selection. For example, in the ABS, d_N was significantly greater than d_S (P <0.05). This pattern was also echoed by results of a likelihood ratio test, and five amino acid sites under significant positive selection were detected by Bayesian analyses. Finally, topology of a Bayesian phylogenetic tree showed that alleles from different anuran families clustered into unique monophyletic groups, but that alleles from different genera within Ranidae did not form monophyletic groups. For example, an allele of Rana clamitans shared a common lineage with alleles of O. tormota. These results suggested that trans-species evolution may be a mechanism that maintains allelic polymorphism of the MHC II B gene across genera in the family Ranidae.

Key words: Odorrana tormota, Amphibians, MHC, class II B gene, positive selection, trans-species evolution

Fang Li, Yilin Shu, Hailong Wu. Polymorphism of exon 2 of MHC Class II B gene in the Chinese concave- eared torrent frog (Odorrana tormota)[J]. Biodiv Sci, 2012, 20(2): 184-192.

Add to citation manager EndNote|Ris|BibTeX

URL: https://www.biodiversity-science.net/EN/10.3724/SP.J.1003.2012.09211

https://www.biodiversity-science.net/EN/Y2012/V20/I2/184

Figures/Tables 5

Table 1 Sequences of the primers used in the study of MHC II B genes variation in the Chinese concave-eared torrent frog

引物 Primer	序列 Sequence (5′-3′)
X1	CGTTGGATATACGATCTGGAGG
X2	GTACTTCGACAGTGATAAGGGATT
S1	GGGTTTCTGTTCCAGGAGTCAG
S2	AGCACTTGGTCTCCCCAGCTCGGT
IIQ1BU	GTACGGAGGATATCAGGTTTC
IIQ1BD	CAGGTGCAGTATATTCCTTCAT

Fig. 1 Amino acid alignment of MHC II alleles of the Chinese concave-eared torrent frog. Sites involved in putative antigen binding sites are indicated by * (according to Brown et al., 1993) or by # (according to Tong et al., 2006), respectively.

Table 2 The average rates of nonsynonymous substitutions per nonsynonymous site (dN) and synonymous substitutions per synonymous site (dS) as well as the resulting ratio dN/dS for the sequenced section, the ABS (putative antigen binding sites) and non-ABS of MHC II B genes exon 2 of the Chinese concave-eared torrent frog.

位点 Sites	同义替换率d_N	非同义替换率d_S	d_N/d_S	Z检验P值 P(Z-test)
All	0.047(0.014)	0.050(0.018)	0.710	0.909
ABS (Brown et al., 1993)	0.116(0.037)	0.046(0.029)	1.081	0.028
Non-ABS (Brown et al., 1993)	0.020(0.011)	0.051(0.025)	0.510	0.075
ABS (Tong et al., 2006)	0.167(0.056)	0.081(0.066)	1.480	0.032
Non-ABS (Tong et al., 2006)	0.025(0.011)	0.044(0.018)	0.491	0.176

Table 3 Summary of parameter estimates and likelihood values of different models of codon evolution for exon 2 of MHC II B gene in the Chinese concave-eared torrent frog

模型 Model	似然值 Likelihood	估计参数 Estimate parameters	(LRT) 2△L	受正选择位点 Positively selected sites
M1	-655.027	p₀= 0.69482 p₁=0.30518 ω₀=0.02484 ω₁=1.00000	52.322 (P<0.001)	None
M2	-628.866	p₀=0.48425 p₁=0.43958 p₂=0.07617 ω₀=0.00000 ω₁=1.00000 ω₂=15.77201	52.322 (P<0.001)	1T^, 10Y^, 34W^*, 43Q^, 59Y^**
M7	-655.106	p= 0.01273 q= 0.02500	52.454 (P<0.001)	None
M8	-628.879	p₀=0.92380 p=0.00503 q=0.00516 (p₁= 0.07620) ω= 16.20861	52.454 (P<0.001)	1T^, 10Y^, 33S, 34W^*, 43Q^, 59Y^**

Fig. 2 Phylogenetic relationship of anuran MHC class II B exon 2 nucleotide sequences constructed with Bayesian inference with two outgroup sequences from the caudate amphibian, Ambystoma tigrinum and Ambystoma mexicanum. Posterior probabilities above 0.95 are indicated on branches.

References 46

[1]	Alcaide M, Edwards SV, Negro JJ (2007) Characterization, polymorphism, and evolution of MHC class II B genes in birds of prey. Journal of Molecular Evolution, 65, 541-554. DOI URL PMID
[2]	Babik W, Pabijan M, Radwan J (2008) Contrasting patterns of variation in MHC loci in the Alpine newt. Molecular Ecology, 17, 2339-2355. DOI URL PMID
[3]	Bai CM, Garner TWJ, Li YM (2010) First evidence of Batrachochytrium dendrobatidis in China: discovery of chytridiomycosis in introduced American bullfrogs and native amphibians in the Yunnan Province, China. EcoHealth, 7, 127-134. URL PMID
[4]	Bos DH, DeWoody JA (2005) Molecular characterization of major histocompatibility complex class II alleles in wild tiger salamanders (Ambystoma tigrinum). Immunogenetics, 57, 775-781. URL PMID
[5]	Bos DH, Waldman B (2006) Evolution by recombination and transspecies polymorphism in the MHC class I gene of Xenopus laevis. Molecular Biology and Evolution, 23, 137-143. URL PMID
[6]	Brown JH, Jardetzky TS, Gorga JC, Stern LJ, Urban RG, Strominger JL, Wiley DC (1993) Three-dimensional structure of the human class II histocompatibility antigen HLA-DR1. Nature, 364, 33-39. URL PMID
[7]	Chen BH (陈璧辉) (1991) The Amphibian and Reptilian Fauna of Anhui (安徽两栖爬行动物志). Anhui Science and Technology Publishing House, Hefei. (in Chinese)
[8]	Cottage A, Yang AP, Maunders H, de Lacy RC, Ramsay NA (2001) Identification of DNA sequences flanking T-DNA insertions by PCR-walking. Plant Molecular Biology Reporter, 19, 321-327.
[9]	Daszak P, Cunningham AA, Hyatt AD (2003) Infectious disease and amphibian population decline. Diversity and Distributions, 9, 141-150.
[10]	Fei L (费梁), Hu SQ (胡淑琴), Ye CY (叶昌媛), Huang YZ (黄永昭) (2009) Fauna Sinica: Amphibia (Vol. 2. Anura) (中国动物志: 两栖纲(中卷无尾目)). Science Press, Beijing. (in Chinese)
[11]	Feng AS, Narins PM, Xu CH, Lin WY, Yu ZL, Qiu Q, Xu ZM, Shen JX (2006) Ultrasonic communication in frogs. Nature, 440, 333-336. DOI URL PMID
[12]	Feng AS, Narins PM, Xu CH (2002) Vocal acrobatics in a Chinese frog, Amolops tormotus. Naturwissenschaften, 89, 352-356. DOI URL PMID
[13]	Harf R, Sommer S (2005) Association between major histocompatibility complex class II DRB alleles and parasite load in the hairy-footed gerbil, Gerbillurus paeba, in the southern Kalahari. Molecular Ecology, 14, 85-91. DOI URL PMID
[14]	Hauswaldt JS, Stuckas H, Pfautsch S, Tiedemann R (2007) Molecular characterization of MHC class II in a nonmodel anuran species, the fire-bellied toad Bombina bombina. Immunogenetics, 59, 479-491. URL PMID
[15]	Hedrick PW, Parker KM (1998) MHC variation in the endangered gila topminnow. Evolution, 52, 194-199. DOI URL PMID
[16]	Hovhannisyan Z, Weiss A, Martin A, Wiesner M, Tollefsen S, Yoshida K, Ciszewski C, Curran SA, Murray JA, David CS, Sollid LM, Koning F, Teyton L, Jabri B (2008) The role of HLA-DQ8 β57 polymorphism in the anti-gluten T-cell response in coeliac disease. Nature, 456, 534-538. URL PMID
[17]	Huelsenbeck JP, Ronquist F (2001) MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics, 17, 754-755. URL PMID
[18]	Jukes TH, Cantor CR (1969) Evolution of protein molecules. In: Mammalian Protein Metabolism (ed. Munro HN), pp. 21-132. Academic Press, New York.
[19]	Kiemnec-Tyburczy KM, Richmond JD, Savage AE, Zamudio KR (2010) Selection, trans-species polymorphism, and locus identification of major histocompatibility complex class IIβ alleles of New World ranid frogs. Immunogenetics, 62, 741-751. DOI URL PMID
[20]	Klein J (1986) Natural History of the Major Histocompatibility Complex, 1st edn. John Wiley and Sons, New York, Chichester, Brisbane, Toronto, Singapore.
[21]	Klein J, Sato A (1998) Birth of the major histocompatibility complex. Scandinavian Journal of Immunology, 47, 199-209. DOI URL PMID
[22]	Langefors Å, Lohm J, Grahn M, Andersen Ø, Von Schantz T (2001) Association between major histocompatibility complex class II B alleles and resistance to Aeromonas salmonicida in Atlantic salmon. Proceedings of the Royal Society B: Biological Sciences, 268, 479-485.
[23]	Laurens V, Chapusot C, del Rosario Ordonez M, Bentrari F, Padros MR, Tournefier A (2001) Axolotl MHC class II beta chain: predominance of one allele and alternative splicing of the beta 1 domain. European Journal of Immunology, 31, 506-515. DOI URL PMID
[24]	Li PP, Lu YY, Li A, Yu LN (2008) The tadpole of a little-known frog, Rana tormotus Wu, 1977. Asiatic Herpetological Research, 11, 71-75.
[25]	May S, Beebee TJC (2009) Characterisation of major histocompatibility complex class II alleles in the natterjack toad, Bufo calamita. Conservation Genetics Resources, 1, 415-417.
[26]	Nei M, Gojobori T (1986) Simple methods for estimating the numbers of synonymous and nonsynonymous nucleotide substitutions. Molecular Biology and Evolution, 3, 418-426. DOI URL PMID
[27]	Nielsen R, Yang Z (1998) Likelihood models for detecting positively selected amino acid sites and applications to the HIV-1 envelope gene. Genetics, 148, 929-936. URL PMID
[28]	Ohta Y, Goetz W, Hossain MZ, Nonaka M, Flajnik MF (2006) Ancestral organization of the MHC revealed in the amphibian Xenopus. The Journal of Immunology, 176, 3674-3685. DOI URL PMID
[29]	Padgett-Flohr GE (2008) Pathogenicity of Batrachochytrium dendrobatidis in two threatened California amphibians: Rana draytonii and Ambystoma californiense. Herpetological Conservation and Biology, 3, 182-191.
[30]	Parham P, Ohta T (1996) Population biology of antigen presentation by MHC class I molecules. Science, 272, 67-74. URL PMID
[31]	Paterson S, Wilson K, Pemberton JM (1998) Major hist- ocompatibility-complex variation associated with juvenile survival and parasite resistance in a large unmanaged ungulate population (Ovis aries L.). Proceedings of the National Academy of Sciences, USA, 95, 3714-3719. DOI URL
[32]	Pounds JA, Bustamante MR, Coloma LA, Consuegra JA, Fogden MPL, Foster PN, Marca EL, Masters KL, Merino-Viteri A, Puschendorf R, Ron SR, Sánchez-Azofeifa GA, Still CJ, Young BE (2006) Widespread amphibian extinctions from epidemic disease driven by global warming. Nature, 439, 161-167. DOI URL PMID
[33]	Richardson DS, Westerdahl H (2003) MHC diversity in two Acrocephalus species: the outbred great reed warble and the inbred Seychelles warbler. Molecular Ecology, 12, 3523-3529. DOI URL PMID
[34]	Sato A, Figueroa F, O’Huigin C, Steck N, Klein J (1998) Cloning of major histocompatibility complex (Mhc) genes from three spine stickleback, Gasterosteus aculeatus. Molecular Marine Biology and Biotechnology, 7, 221-231. URL PMID
[35]	Shen JX, Feng AS, Xu ZM, Yu ZL, Arch VS, Yu XJ, Narins PM (2008) Ultrasonic frogs show hyperacute phonotaxis to female courtship calls. Nature, 453, 914-916. URL PMID
[36]	Shen JX, Xu ZM, Yu ZL, Wang SA, Zheng DZ, Fan SC (2011) Ultrasonic frogs show extraordinary sex differences in auditory frequency sensitivity. Nature Communications, 2, 342. doi: 10.1038/ncomms1339. URL PMID
[37]	Su X, Wu XB, Yan P, Cao SY, Hu YL (2007) Rearrangement of a mitochondrial tRNA gene of the concave-eared torrent frog, Amolops tormotus. Gene, 394, 25-34. DOI URL PMID
[38]	Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA 4: Molecular Evolutionary Genetics Analysis (MEGA4) software version 4.0. Molecular Biology and Evolution, 24, 1596-1599. DOI URL PMID
[39]	Teacher AGF, Garner TWJ, Nichols RA (2009) Evidence for directional selection at a novel major histocompatibility class I marker in wild common frogs (Rana temporaria) exposed to a viral pathogen (Ranavirus). PLoS ONE, 4, e4616. DOI URL PMID
[40]	Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG (1997) The CLUSTAL X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research, 25, 4876-4882. URL PMID
[41]	Tong JC, Bramson J, Kanduc D, Chow S, Sinha AA, Ranganathan S (2006) Modeling the bound conformation of pemphigus vulgaris-associated peptides to MHC Class II DR and DQ alleles. Immunome Research, 2, 1. DOI URL PMID
[42]	Westerdahl H, Waldenstrom J, Hansson B, Hasselquist D, von Schantz T, Bensch S (2005) Associations between malaria and MHC genes in a migratory songbird. Proceedings of the Royal Society B: Biological Sciences, 272, 1511-1518.
[43]	Wong WSW, Yang ZH, Goldman N, Nielsen R (2004) Accuracy and power of statistical methods for detecting adaptive evolution in protein coding sequences and for identifying positively selected sites. Genetics, 168, 1041-1051. URL PMID
[44]	Yan JC, Luo TL, Wu HL (2011) Development and charac- terization of twelve polymorphic microsatellite loci for the Chinese concave-eared frog (Odorrana tormota). Conser- vation Genetics Resource, 3, 225-227.
[45]	Yang ZH (1997) PAML: a program package for phylogenetic analysis by maximum likelihood. Computer Applications in the Biosciences, 13, 555-556. URL PMID
[46]	Zeisset I, Beebee TJC (2009) Molecular characterization of major histocompatibility complex class II alleles in the common frog, Rana temporaria. Molecular Ecology Resources, 9, 738-745. URL PMID